Determination of STAT5A Gene SNPs and Their Association with Reproductive Traits in Ongole Grade Cow of Rembang

Ahyuni Indah Wati; Daud Samsudewa; E T Setiatin; E Kurnianto; D A Lestari

doi:10.14334/jitv.v30i1.3484

Determination of STAT5A Gene SNPs and Their Association with Reproductive Traits in Ongole Grade Cow of Rembang

Ahyuni Indah Wati, Daud Samsudewa, E T Setiatin, E Kurnianto, D A Lestari

DOI

https://doi.org/10.14334/jitv.v30i1.3484

Abstract

The Ongole Grade cows are known for their good reproductive efficiency. However, it has not been confirmed through more in-depth research regarding the genes that have significant contributions and can serve as genetic markers for reproductive traits. The Signal Transducer and Activator of the Transcription 5A (STAT5A) gene is suspected to mediate in the reproductive hormone signaling pathway, significantly influencing reproductive traits. This study aims to determine the association between the STAT5A gene as a selection marker for reproductive traits service/conception (S/C), calving interval (CI), days open (DO), and estrus post partus (EPP). The sample used was 79, based on the rank that was determined according to the SNI Ongole Grade cow in 2015. The research method was carried out by isolating DNA, PCR, and DNA sequencing using the Sanger method and with primers GAGAAGTTGGCGGAGATTATC (Forward) and CCGTGTGTCCTCATCACCTG (Reverse). The sequencing results showed an 820 bp DNA band according to the results of primary blasting in NCBI in the eighth exon. Data analysis used multivariate prin-cipal component analysis (PCA) and non-parametric contingency lambda analysis. The results showed a significant association between the STAT5A gene and reproductive parameters in the g.482 G>A mutation; this indicates that the STAT5A gene is im-portant in improving reproductive quality and can be used as a marker for selecting superior Ongole Grade cows in the Rembang Regency.

Keywords

Association; Gene Expression; Ongole Grade Cow; Rembang Regency; Reproduction Paramaters; STAT5A Gene

Full Text:

PDF

References

Asmarasari SA, Sumantri C, Mathius IW, Anggraeni A. 2014. Diacylglycerol Acyltransferase1 gene polymorphism and its association with milk fatty acid components in Holstein Friesian dairy cattle. JITV. 19:159-167.DOI: 10.14334/jitv.v19i3.1078.

Basant M, Sherif I, Ramadan , Mohamed E, Eman M, Abd EF. 2022. Polymorphism of the Signal Transducer and Activator of Transcription 5A (STAT5A) gene in Egyptian water buffaloes using the SSCP technique. BJAS. 7:173-177. DO:10.21608/bjas.2022.244768.

[BSN] Badan Standarisasi Nasional. 2015. SNI 7651.5:2015. Bibit sapi potong. Bagian 5: Peranakan ongole. Jakarta (Indones): Badan Standarisasi Nasional.

Busyro, Nurhantari Y. 2020. Data genetik dari empat lokus Short Tandem Repeat (STR): TPOX, D3S1358, D7S820, dan CFS1PO pada populasi Indonesia. J Indones Forensic Legal Med. 2:150-155.

Indahwati A, Kurnianto E, Setiatin ET, Samsudewa D. 2022. Evaluation of breeder preferences on reproduction aspects of Ongole Grade in the breeding area of Rembang Regency. ISSRP. (CAN NOT FIND THIS RFERENCE)

Juniarti R. 2015. Identifikasi Keragaman Gen Signal Transducer And Activator of Transcription 5a (STAT5A) Promoter p ada Sapi Bali [Thesis]. Bogor (Indones): Faculty of Animal Science, IPB Unversity.

Khatib H, Maltecca C, Monson RL, Schutzkus V, Rutledge JJ. 2009. Monoallelic maternal expression of STAT5A affects embryonic survival in cattle. BMC Genet. 10. DOI:10.1186/1471-2156-10-13.

Lestari DA, Sutopo, Setiaji A, Kurnianto E. 2023. Genetic diversity and phylogenetic study of Ongole grade cattle population in Central Java based on blood protein polymorphism. Biodiv. 24:617-624. DOI:10.13057/biod iv/d240170.

Liu W, Ji Y, Xhang B, Chu H, Yin C, Xiao Y. 2020. STAT5A promotes brown adipocyte differentiation and thermogenic program through binding and transactivating the Kdm6a promote. National Library of Medicine. 19: 895-905. DOI:10.1080/15384101.2020. 1731644.

Michel RNG, Ayala VMÁ, Galindo GJ, Duifhuis RT, Sánchez CDR and Valencia PM. 2020. Effect of COQ9 and STAT5A polymorphisms on reproductive performance in a Holstein cow herd in Mexico. Animal Reproduction 17:e20200039. DOI:10.1590/1984-3143-AR2020-0039.

Nei M, Kumar S. 2000. Molecular evolution and phylogenetics. New York (USA): Oxford University Pr.

Michel-Regalado NG, Ayala-Valdovios MÁ, Galindo-García J, Duifhuis-Rivera T, Sánchez-Chiprés DR, Valencia-Posadas M. 2020. Effect of COQ9 and STAT5A polymorphisms on reproductive performance in a Holstein cow herd in Mexico. J Anim Reprod. 4:e20200039. DOI:10.1590 /1984-3143-AR2020-0039.

Panjono, Priyanti A, Aryogi, Putra ARS, Atmoko BA, Maulanan H, Prabowo BW. 2022. Kinerja induk sapi peranakan ongole di Kecamatan Kragan Kabupaten Rembang. J Ilmiah Fillia Cendekia. 7:66-71. DOI:10.325 03/fillia.v7i1.2344.

Paramitasari KA, Sumantri C. 2015. The genetic variability of prolactin and signal transducers and activators of transcription 5A (STAT5A) genes in Bali Cattle. MedPet.38:1-11. DOI:10.5398/medpet.2015.38.1.1.

Pratiwi WR, Panjono, Bintara S. 2022. Kinerja induk sapi PO, Simpo dan Limpo di Kabupaten Rembang, Jawa Tengah. [Thesis]. Yogyakarta (Indones): Gadjah Mada University.

Prihandini PW, Primasari A, Luthfi M, Pamungkas D. 2020. Identifikasi keragaman gen follicle stimulating hormone sub-unit beta (FSH-?) pada tiga sumber daya genetik sapi lokal Indonesia. In Prosiding Seminar Nasional Teknologi Peternakan dan Veteriner.Bogor (Indones): ICARD. pp. 183-191

Putri RF, Nugraha CD, Furqon A, Septian WA, Suyadi S. 2021. Identifikasi keragaman genetik gen inhibin subunit alpha (INHA) dan inhibin subunit beta A (INHBA) pada sapi peranakan Ongole (PO). JTRAPO. 22:69-76. DOI:10.21776/ub.jtapro.2021.022.01.9.

Selvaggi M, Tufarelli V, Pinto F, Centoducati G, Dambrosio A, Santacroce MP, Dario C. 2013. Bovine STAT5A gene polymorphism analysis and its association with milk composition traits in Jersey cows. Int J Biosci Biochemist Bioinform. 3:341-344.

Sudhakar K, Aranganoor TK, Ramasamy S, Nagarajan M. 2021. Single nucleotide polymorphism in STAT5A could not endorse variation in milk production traits in Indian bovine population. Acta Vet Hungarica. 60:324–333. DOI:10.1556/004.2021.00046.

Sudaryanto AT, Sutopo, Kurnianto E. 2018. Keragaman fenotipe sapi peranakan Ongole di wilayah sumber bibit di Jawa Tengah. J Vet. 19:478-487. DOI:10.19087/j veteriner.2018.19.4.478.

Sudrajad P, Volkandari SD, Cahyadi M, Prasetyo A, Komalawati, Wibowo S, Subiharta. 2021. Pemanfaatan informasi genom untuk eksplorasi struktur genetik dan asosiasinya dengan Performansn ternak di Indonesia. Livest Anim Res. 19:1-12. DOI:10.20961/lar.v19i1.4 7658.

Sutiyono, Sutopo, Ondho YS, Setiatin ET, Samsudewa D, Suryawijaya A, Lestari DA, Kurnianto E. 2018. Short communication : genetic diversity of Ongole grade cattle of Rembang District, Central Java, Indonesia, based on blood protein polymorphism. Biodiversitas. 19:1429-1433. DOI:10.13057/biodiv/d190432.

Tina S, Jamuna V, Kulangara, Anilkumar, Aravindakshan. 2022. STAT5A polymorphism could be a promising indirect marker to improve milk production in crossbred cattle of Kerala. Indian Journal of Animal Sciences 92(6): 746–750. CAN NOT FIND THIS REFERENCE.

Yendraliza A. Ali, Harahap AE, Misrianti R. 2017. Perbandingan Kualitas Semen, Pakan dan Gen STAT5A Ternak Lokal Provinsi Riau dengan Komoditi Ternak Asia Tenggara. Laporan Penelitian Internasional. Balitbang UIN Sultan Syarif Kasim, Riau. COULD YOU REPLACE THIS REFERENCE WITH JOURNALS?

Yurnalis, Sarbaini. 2014. Keragaman sekuen gen reseptor hormone pertumbuhan Exon 10 sebagai informasi dasar seleksi pada sapi Pesisir plasma nuftah Sumatera Barat. J Peternak Indones. 16:63-70. DOI:10.25077/jpi.16.1.63-70.2014.